Rearrangement Information

NamegkDf2 View on WormBase
Descriptionno description available
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
VC100 unc-112(r367) V; gkDf2 X. C. elegans gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807