AF1 |
+/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT. |
CB3475 |
mcm-4(e1466)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and thin sterile Unc animals. Maintain by picking WT. |
CB3533 |
+/szT1 [lon-2(e678)] I; twk-18(e1913)/szT1 X. |
C. elegans |
Heterozygotes are Unc and segregate Unc, dead eggs, and Lon males. e1913 is a dominant Unc and recessive lethal. Maintain by picking Unc. e1913 previously called unc-110. |
CGC28 |
+/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC35 |
+/szT1 [lon-2(e678) umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC40 |
+/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC41 |
+/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9. |
CGC46 |
+/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs35] X. |
C. elegans |
umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC50 |
+/szT1 [lon-2(e678) umnIs39] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs40] X. |
C. elegans |
umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC79 |
+/szT1 [lon-2(e678) umnIs61] I; dpy-8(e1321) unc-3(e151)/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
CGC97 |
+/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs77] X. |
C. elegans |
umnIs77 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. |
DA1077 |
egl-30(ad810) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males. |
DA1096 |
egl-30(ad810)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males. |
EU307 |
+/szT1 [lon-2(e678)] I; mom-1(or46) dpy-6(e14)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or46. |
EU308 |
+/szT1 [lon-2(e678)] I; mom-1(or10) dpy-6(e14)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or10. |
EU361 |
+/szT1 [lon-2(e678)] I; mom-1(or10) unc-6(n102)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Uncs with a protruding vulva, Long males and dead eggs. Uncs give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or10 is a recessive maternal-effect embryonic lethal. Zygotic phenotype of or10 is protruding vulva and slight uncoordination. |
GE1386 |
tDf3 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Strain will occasionally throw some DpysRollers. |
GE1549 |
tDf4 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. Strain will occasionally throw some DpysRollers. |
HL2000 |
+/szT1 [lon-2(e678)] I; nhr-25(jm2389)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. nhr-25 is homozygous embryonic lethal. |
HR1184 |
+/szT1 [lon-2(e678)] I; nmy-1(sb115) dpy-8(e130)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy Uncish with occasional Rol (nmy-1 dpy-8), Lon males, and dead eggs. nmy-1 homozygotes have a low brood size and are slow growing. sb115 is a null, truncation allele. |
HR890 |
+/szT1 [lon-2(e678)] I; syDf1/szT1 X. |
C. elegans |
Heterozygotes are Lon and segregate Lon and dead eggs. |
JK323 |
qDf3/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and grow slowly. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
JM69 |
dpy-5(e61) unc-13(e1091)/szT1 [lon-2(e678)] I; elt-2(ca15)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. |
KM48 |
+/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. |
C. elegans |
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad. |
KR1115 |
dpy-5(e61) unc-13(e450) hDf9/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype, Him. Segregates wild-type, Lon-2 males and two classes of arrested embryos (dpy-5 unc-13 hDf9 homozygotes and szT1 aneuploids). Lon males are fertile, carrying hDf9 and both szT1 half translocations (arising by meiotic nondisjunction of normal X chromosome). Maintain by picking wild-type and checking for correct segregation of progeny. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
KR1142 |
hDf8/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
KR1537 |
dpy-5(e61) let-540(h884) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygote is wild-type, segregating WT, late-larval arresting DpyUncs, szT1 homozygotes (lethal, probably embryonic), and aneuploids (dead eggs). Pick WT and check for correct segregation of progeny to maintain stock. Note that some lethals recovered by hT1 are expected to be outside the szT1 crossover suppression boundary and these strains may thus produce DpyUnc progeny. unc-29 marker may also cross away from szT1(I). |
KR1588 |
dpy-5(e61) let-539(h938) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
KR1594 |
dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
KR1598 |
dpy-5(e61) unc-13(e450) let-538(h990)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype. Segregates WT, sterile adult DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I. |
KR1692 |
dpy-5(e61) unc-13(e450) let-535(h993)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype. Segregates WT, mid-larval arrested DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I. |
KR1694 |
let-508(h995) dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
|
KR3910 |
dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpys, Lon males and dead eggs. |
KR926 |
hDf6 dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678)] I; unc-3(e151)/szT1 X. |
C. elegans |
This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
ML855 |
+/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development. |
MT1401 |
+/szT1 [lon-2(e678)] I; nDf19/szT1 X. |
C. elegans |
Hets are WT and throw WT, dead eggs and Lon males. Maintain by picking WT. |
MT1442 |
mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT. |
MT3460 |
+/szT1 I; dpy-6(e14) egl-15(n1454)/szT1 [lon-2(e678)] X. |
C. elegans |
WT strain which segregates WT, Dpy L1 lethals, Lon males and dead eggs. Class II egl-15 mutation. |
NH2693 |
+/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP). |
RE249 |
qDf4/szT1 I; +/szT1 [lon-2(e678)] X. |
C. elegans |
Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
RG3078 |
+/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3151 |
+/szT1 [lon-2(e678) umnIs61] I; T20B5.2(ve651[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygotes are unhealthy. Deletion of 5228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sickly adults (ve651 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaggggagggaaaacagttgaggacttttg ; Right flanking sequence: GAATGCGCATACTTGATGGAAAACCCGCTC. sgRNA #1: aacagttgaggacttttggt; sgRNA #2: ATCAAGTATGCGCATTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
RG3202 |
+/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
SD1135 |
+/szT1 [lon-2(e678)] I; dlg-1(ok318)/szT1 X. |
C. elegans |
|
TU900 |
+/szT1 [lon-2(e678)] I; uDf1/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.] |
TY404 |
+/szT1 [lon-2(e678)] I; lin-15B&lin-15A(n765) yDf1/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. |
TY562 |
+/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf3/szT1 X. |
C. elegans |
Unc. Throws Unc, UncLon males and dead eggs. |
TY567 |
+/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. |
C. elegans |
Unc. Throws Unc, UncLon males and dead eggs. |
TY578 |
+/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf5/szT1 X. |
C. elegans |
Unc. Throws Unc, UncLon males and dead eggs. |
TY714 |
+/szT1 [lon-2(e678)] I; sdc-2(y46)/szT1 X. |
C. elegans |
Heterozygotes are WT. |