Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NameszT1 View on WormBase
Descriptionbalancer chromosome for X Handling: Easy to manipulate. Lon-2 szT1 males mate well. Rare exceptional progeny carry one half-translocation as a complex free duplication. Gives rise spontaneously to rare apparent lethal mutations that may represent fusion of szT1(X) and the normal X. Shows threefold enhanced recombination frequency immediately adjacent to right of LG I breakpoint and about twofold enhanced frequency in the unc-101 - unc-54 interval. Summary: Reciprocal translocation, well characterized, very stable. Effective balancer for left portion of LG I through unc-13, nearly all of LG X from right end to around dpy-3. szT1(I) is large segment of LG X (right) translocated to LG I, disjoins from normal LG I. szT1(X) is LG I (left) translocated to fragment of LG X (left), disjoins from normal LG X. Recommended use: General balancing, strain construction, strain maintenance.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
AF1 +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT.
CB3475 mcm-4(e1466)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males and thin sterile Unc animals. Maintain by picking WT.
CB3533 +/szT1 [lon-2(e678)] I; twk-18(e1913)/szT1 X. C. elegans Heterozygotes are Unc and segregate Unc, dead eggs, and Lon males. e1913 is a dominant Unc and recessive lethal. Maintain by picking Unc. e1913 previously called unc-110.
CGC28 +/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC35 +/szT1 [lon-2(e678) umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC40 +/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC41 +/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.
CGC46 +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs35] X. C. elegans umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC50 +/szT1 [lon-2(e678) umnIs39] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs40] X. C. elegans umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC79 +/szT1 [lon-2(e678) umnIs61] I; dpy-8(e1321) unc-3(e151)/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC97 +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs77] X. C. elegans umnIs77 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
DA1077 egl-30(ad810) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males.
DA1096 egl-30(ad810)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males.
EU307 +/szT1 [lon-2(e678)] I; mom-1(or46) dpy-6(e14)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or46.
EU308 +/szT1 [lon-2(e678)] I; mom-1(or10) dpy-6(e14)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or10.
EU361 +/szT1 [lon-2(e678)] I; mom-1(or10) unc-6(n102)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Uncs with a protruding vulva, Long males and dead eggs. Uncs give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or10 is a recessive maternal-effect embryonic lethal. Zygotic phenotype of or10 is protruding vulva and slight uncoordination.
GE1386 tDf3 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males and dead eggs. Strain will occasionally throw some DpysRollers.
GE1549 tDf4 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. Strain will occasionally throw some DpysRollers.
HL2000 +/szT1 [lon-2(e678)] I; nhr-25(jm2389)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, dead eggs, and Lon males. nhr-25 is homozygous embryonic lethal.
HR1184 +/szT1 [lon-2(e678)] I; nmy-1(sb115) dpy-8(e130)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Dpy Uncish with occasional Rol (nmy-1 dpy-8), Lon males, and dead eggs. nmy-1 homozygotes have a low brood size and are slow growing. sb115 is a null, truncation allele.
HR890 +/szT1 [lon-2(e678)] I; syDf1/szT1 X. C. elegans Heterozygotes are Lon and segregate Lon and dead eggs.
JK323 qDf3/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and grow slowly. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JM69 dpy-5(e61) unc-13(e1091)/szT1 [lon-2(e678)] I; elt-2(ca15)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males and dead eggs.
KM48 +/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. C. elegans 745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.
KR1115 dpy-5(e61) unc-13(e450) hDf9/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Wild-type phenotype, Him. Segregates wild-type, Lon-2 males and two classes of arrested embryos (dpy-5 unc-13 hDf9 homozygotes and szT1 aneuploids). Lon males are fertile, carrying hDf9 and both szT1 half translocations (arising by meiotic nondisjunction of normal X chromosome). Maintain by picking wild-type and checking for correct segregation of progeny. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1142 hDf8/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1537 dpy-5(e61) let-540(h884) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans Heterozygote is wild-type, segregating WT, late-larval arresting DpyUncs, szT1 homozygotes (lethal, probably embryonic), and aneuploids (dead eggs). Pick WT and check for correct segregation of progeny to maintain stock. Note that some lethals recovered by hT1 are expected to be outside the szT1 crossover suppression boundary and these strains may thus produce DpyUnc progeny. unc-29 marker may also cross away from szT1(I).
KR1588 dpy-5(e61) let-539(h938) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1594 dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1598 dpy-5(e61) unc-13(e450) let-538(h990)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans Wild-type phenotype. Segregates WT, sterile adult DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.
KR1692 dpy-5(e61) unc-13(e450) let-535(h993)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans Wild-type phenotype. Segregates WT, mid-larval arrested DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.
KR1694 let-508(h995) dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. C. elegans
KR3910 dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Dpys, Lon males and dead eggs.
KR926 hDf6 dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678)] I; unc-3(e151)/szT1 X. C. elegans This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
ML855 +/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.
MT1401 +/szT1 [lon-2(e678)] I; nDf19/szT1 X. C. elegans Hets are WT and throw WT, dead eggs and Lon males. Maintain by picking WT.
MT1442 mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT.
MT3460 +/szT1 I; dpy-6(e14) egl-15(n1454)/szT1 [lon-2(e678)] X. C. elegans WT strain which segregates WT, Dpy L1 lethals, Lon males and dead eggs. Class II egl-15 mutation.
NH2693 +/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).
RE249 qDf4/szT1 I; +/szT1 [lon-2(e678)] X. C. elegans Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RG3078 +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3151 +/szT1 [lon-2(e678) umnIs61] I; T20B5.2(ve651[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygotes are unhealthy. Deletion of 5228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sickly adults (ve651 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaggggagggaaaacagttgaggacttttg ; Right flanking sequence: GAATGCGCATACTTGATGGAAAACCCGCTC. sgRNA #1: aacagttgaggacttttggt; sgRNA #2: ATCAAGTATGCGCATTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3202 +/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. C. elegans umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SD1135 +/szT1 [lon-2(e678)] I; dlg-1(ok318)/szT1 X. C. elegans
TU900 +/szT1 [lon-2(e678)] I; uDf1/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.]
TY404 +/szT1 [lon-2(e678)] I; lin-15B&lin-15A(n765) yDf1/szT1 X. C. elegans Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT.
TY562 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf3/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY567 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY578 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf5/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY714 +/szT1 [lon-2(e678)] I; sdc-2(y46)/szT1 X. C. elegans Heterozygotes are WT.