| EU1516 |
aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56). |
| EU311 |
dpy-5(e61) mom-5(or57)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys give only embryonic lethals which lack endoderm and make excess mesoderm. or57 is a recessive maternal-effect lethal. |
| EU407 |
mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV; lin-2(e1309) X. |
C. elegans |
|
| EU414 |
unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. |
| EU443 |
unc-13(e1091) mom-4(or11)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or11 is a recessive maternal-effect embryonic lethal. |
| EU446 |
unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. |
| EU447 |
unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV. |
C. elegans |
Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. Throws males. |
| EU452 |
mom-5(zu193) unc-13(e1091)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozgyotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. |
| EU459 |
unc-13(e1091) mom-5(zu193)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. |
C. elegans |
Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects. |
| EU927 |
dpy-5(e61) mom-4(or49)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs and dead eggs. |
| EV190 |
gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36. |
| EV57 |
gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494. |
| FT207 |
tat-5(tm1741) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. tm1741 homozygotes are small and sterile. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9. |
| FX301 |
gsp-2(tm301) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| GC589 |
pab-1(ar232)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+, and segregate Sterile non-GFP (homozygous ar232) and dead eggs. ar232 have severely reduced germline proliferation. |
| GIN101 |
thoc-2(tm1310) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9. |
| GIN102 |
thoc-2(tm1310) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). |
C. elegans |
Maintain by picking Unc GFP progeny that produce viable embryos and checking that the non-GFP progeny that are produced fail to give viable progeny. tm1310 is a homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are Unc with pharyngeal GFP signal, and segregate Unc GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2 [bli-4 let-? qIs48] inviable. ok79 heterozygotes are Unc and segregate Uncs, dead eggs, and Him ok79 homozygotes (maternally rescued). Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9. |
| HA2823 |
smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. |
C.elegans |
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752. |
| HA2825 |
smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. |
C.elegans |
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752 |
| HR1275 |
src-1(cj293) dpy-5(e61)/hT2 [bli-4(e937) let-?(h661)] I; +/hT2 III. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs. |
| HR492 |
+/hT2 I; vab-7(e1562) mel-44(sb44)/hT2 [bli-4(e937) let-?(h661)] III. |
C. elegans |
Dominant ts maternal-effect embryonic lethal. Embryos arrest prior to morphogenesis or at two-fold. Non-ts recessive mid-larval lethal. Maintain at 15C. Freezes poorly. |
| HS1204 |
rmd-1&T05G5.9(tm1457) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are green and segregate green WT, dead eggs and nonGreens that lay dead eggs with the defects in spindle organization, chromosome segregation, and cytokinesis. |
| HS1673 |
lin-17(n3091) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); vpIs1 X. |
C. elegans |
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308. |
| HS1749 |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308. |
| HS1790 |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) V. |
C. elegans |
mig-1 confirmed by complementation tests, and cfz-2 by PCR. Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308. |
| HS2067 |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) wIs51 V; lin-18(e620) X. |
C. elegans |
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308. |
| HS399 |
let-526(os37) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. os37 homozygotes are Lvl and Psa. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57. |
| HS411 |
ceh-20(os39) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division. |
| HS732 |
wrm-1(tm514) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. |
| HS886 |
bet-1(os46) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP in the pharynx, and segregate WT GFP+, Sterile Psa(Phasmid socket absent) non-GFP homozygous os46) animals and dead eggs. Maintain by picking GFP progeny. Reference: Shibata et al. Development in press (2010). |
| JEK1001 |
ddx-15 (tm4014) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4014 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The tm4014 allele was provided by the National BioResource Project (NBRP, for C. elegans). |
| JK2689 |
pop-1(q645) dpy-5(e61) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and glow, segregate non-glowing Dpy Steriles. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK2739 |
mcm-4(e1466) dpy-5(e61) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing sterile Dpys, very rare homozygous hT2 glowing animals, and dead eggs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK2751 |
sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK2782 |
pop-1(q645) unc-11(e47) I/hT2 (I;III). |
C. elegans |
Heterozygotes are WT and segregate WT, Dpys (hT2 homozygotes) and Unc Steriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK2810 |
mcm-4(e1466) dpy-5(e61)/hT2 I; dpy-18(e364) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are medium Dpy and glowing. Hets throw small, sterile DpyUncs and dead eggs. hT2[bli-4(e937) qIs48] is homozygous lethal. qIs48 is an insertion of ccEx9747 with markers myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embyro, and gut promoter F22B7.9 driving GFP in the intestine. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK2878 |
fog-1(q325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT green-glowing heterozygotes and non-glowing Fogs. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK2879 |
gld-2(q497) gld-1(q485)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-2 gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK2944 |
pop-1(q645) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT green-glowing heterozygotes and non-glowing steriles. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK2945 |
pop-1(q624) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
q624 has variable gonad defects and can be maintained as a homozygote. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| JK3025 |
gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Jeong J, et al. PLoS Genet. 2011 Mar;7(3):e1001348. |
| JK3221 |
sys-1(q736) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT, but frequently sterile when balanced by hT2[qIs48]. q736 is homozygous embryonic lethal. (Approx. 5% of hets are Sterile when balanced by WT.) hT2[qIs48] homozygotes are inviable. q736 is a deletion of sys-1 deleting from nucleotide 1803 to nucleotide 3992 of the genomic sequence (a of start atg is position 1). Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK3361 |
qIs76 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
qIs76 [tra-1::GFP::beta-GAL + rol-6(su1006)]. Rollers express TRA-1::GFP in Z1/Z4, intestine, etc. qIs76 homozygotes are lethal. Heterozygotes are Rol GFP+ (pharynx). Pick Rollers with GFP+ pharynx to maintain. Reference: Chang W., et al. Development. 2004 Mar;131(6):1425-36. |
| JK3501 |
pop-1(q772) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. q772 is embryonic lethal. |
| JK3743 |
fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JK3934 |
gld-1(q93) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). |
C. elegans |
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP gld-1(q93) homozygotes with masculinized germlines. Some heterozygotes will also have a masculinized germline. Maintain by picking GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. gld-1(q93) was isolated as a dominant suppressor of fem-1(hc17). |
| JK4087 |
rnp-8(q784) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. rnp-8 homozyotes are GFP- and look like WT. Slow L4 to Adult transition. |
| JK4299 |
gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121. |
| JK4307 |
rnp-8(tm2435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. PCR using 3 primers: primer A: TCA GCC GAC AAT CTC CGA; primer B: GTA CTG ATT GTA TCC ACC GGC; primer C: GCT CAT AGA AAA GCG ATG G. WT band = 0.5 kb; heterozygote bands = 0.8 and 0.5 kb (double bands), tm2435 bands = 0.8 kb. |
| JK4563 |
gld-1(q126) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |