Rearrangement Information

NamenDf58 View on WormBase
Descriptionno description available
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
MT14767 mir-54&mir-55(nDf58) X. C. elegans Deletion breakpoints are: GAATGTTCACTGAGCTCTACATCATTG / TTCAAACAGTTT...AAGTTGTGATCTAC / AATTATCTTTGGATTTTTAATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17136 nDf67 IV; nDf58 X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT17137 mir-51(n4473) IV; nDf58 X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT17143 nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. C. elegans Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
MT17446 mir-53(n4113) mir-52(n4100) IV; nDf58 X. C. elegans Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.