Rearrangement Information
| Name | nDf56 View on WormBase |
|---|---|
| Description | no description available |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
Strains carrying this rearrangement
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MT14449 | mir-232(nDf56) IV. | C. elegans | Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17631 | nDf56 IV; nDf60 V. | C. elegans | Reference: Curr Bio (2010) 20:367-73. |