Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NameeT1 View on WormBase
Description[Edgley M] Reciprocal translocation. Suppresses recombination on left arm of LG V and right arm of LG III. Breaks in unc-36. Homozygous viable with Unc-36 phenotype. Summary: Reciprocal translocation, well characterized, extremely stable. Very effective balancer for left portion of LG V from left end through unc-23, and right portion of LG III from right end to unc-36. eT1(III) is LG V (left) translocated to LG III (left), disjoins from normal LG III. eT1(V) is LG III (right) translocated to LG V (right), disjoins from normal LG V. Zhao et al. reports the sequence of the physical breakpoint of eT1 on chromosome V (the breakpoint of eT1 chromosome III is in the unc-36 gene). Growth characteristics: Original isolate homozygous viable with Unc-36 phenotype caused by the translocation breakpoint. Brood size in heterozygotes ~ 100, in homozygotes ~160. eT1 homozygotes can overgrow a population, especially in balanced strains carrying certain lethal mutations or deficiencies. Handling: Easy to manipulate. Heterozygous male stock mate well. 20-bp sequences of either side of the eT1 breakpoints are as follows, eT1(V): aataatttttgaaacaaaaa-GTTTATCATCTCAAGACGTG; eT1(III): GAGCCAATCACTTACTGGTTAGTAATGATTCCAAATATGAGCCAATCACTTACTGGTTAGTAATGATTCCAAA-cttgattccaaatatgacat Phenotype: Unc Recommended use: General balancing, strain construction, strain maintenance, and mutant screens. cross-over sup left of V, right of III;'allele' of unc-36(III); e873
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
JS83 air-1(vw5) V/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
JT5132 +/eT1 III; exp-2(sa26)/eT1 [let-?(n886)] V. C. elegans Heterozygotes have jerky movement, are Exp defective, and are Egl (dominant). Homozygous exp-2 are recessive lethal. Homozygous eT1 are lethal also.
MT10784 dpy-18(e364) lis-1(n3334) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.
MT12960 epc-1(n4076) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
MT12963 ssl-1(n4077) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
MT1965 lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. C. elegans Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.
MT20112 +/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20113 unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20114 eT1 (III;V); nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
MT2583 dpy-11(e224) nDf32 V/eT1 (III;V). C. elegans Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
MT2590 +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
MT5491 nDf40 dpy-18(e364) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.
MT7482 sqv-3(n2823) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36, and Sqvs which have an abnormal vulva from mid-L4 and are sterile.
MT7553 dpy-19(e1259) sqv-3(n2842)/eT1 III; +/eT1 V. C. elegans Heterozygotes are WT and segregate WT, DpySqv, Unc-36 and dead eggs.
MT7556 sqv-3(n2842)/eT1 III; +/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Sqv, Unc-36 and dead eggs.
NW1619 dpy-11(e224) mig-6(ev700) V/eT1 (III;V). C. elegans Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1623 dpy-11(e224) mig-6(ev788) V/eT1 (III;V). C. elegans Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1625 dpy-11(e224) mig-6(e1931) V/eT1 (III;V). C. elegans Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
RG3225 Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. C. elegans umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
TY415 unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. C. elegans WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
VC109 apc-11(gk37)/eT1 III; +/eT1 V. C. elegans F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC112 ccf-1(gk40)/eT1 III; +/eT1 IV. C. elegans Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC173 +/eT1 III; gck-1(gk137)/eT1 V. C. elegans T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC180 +/eT1 III; tnt-4(gk136)/eT1 V. C. elegans T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC269 sqv-3&vha-1(ok513)/eT1 III; +/eT1 V. C. elegans R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC301 ant-1.1(gk172)/eT1 III; +/eT1 V. C. elegans T27E9.1. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk172 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC315 +/eT1 III; mrck-1(ok586)/eT1 V. C. elegans K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC370 rfp-1(ok572)/eT1 III; +/eT1 V. C. elegans R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3895 Y79H2A.4(gk3813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/eT1 III; +/eT1 V. C. elegans Apparent homozygous lethal or sterile deletion balanced by eT1. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACAGTGAAAATTTGAATATGCGCG. Right flanking sequence: AATTGGAATGGAAAAGAGCTGGACGCTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC402 +/eT1 III; cdc-25.2(ok597)/eT1 V. C. elegans F16B4.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok597 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807