Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NamemT1 View on WormBase
Description[Mark Edgley ] Induced with 1500R gamma. Marked with dpy-10(e128), homozygous sterile. Broods from a heterozygote are small, with large numbers of dead eggs. Heterozygous male stocks mate, but mT1 is not transferred at high frequency. [Mark Edgley ] Induced with 1500R gamma. Marked with dpy-10(e128), homozygous sterile. Broods from a heterozygote are small, with large numbers of dead eggs. Heterozygous male stocks mate, but mT1 is not transferred at high frequency. Recommended use: General balancing, strain maintenance, mutant screens. Growth characteristics: Original isolate marked with dpy-10(e128). Translocation probably breaks in an essential gene, as mT1 homozygotes are sterile. Handling: Easy to manipulate. Heterozygous males mate reasonably well. Summary: Reciprocal translocation, well characterized, very stable. Very effective balancer for right portion of LG II from the right end through dpy-10, and the right portion of LG III from the right end to between daf-2 and unc-93. mT1(II) is probably LGII (right) translocated to LG III (left), disjoins from normal LG III. mT1(III) is probably LG III (right) translocated to LG II (left), disjoins from normal LG II.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
CGC17 unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. C. elegans umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
CGC45 unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. C. elegans umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC65 mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs51]/dpy-17(e164) III. C. elegans umnIs51 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC66 unc-4(e120)/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC68 mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs54]/dpy-17(e164) III. C. elegans umnIs54 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
DM7438 +/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III; raEx438. C. elegans raEx438 [pxl-1p::pxl-1a(cDNA)::GFP + rol-6(su1086)]. Rollers. Transgene does not rescue ok1483 L1 lethality. Transgenic (Rol) heterozygotes segregate rolling non-Dpy (heterozygotes carrying raEx438), non-rolling non-Dpy (heterozygotes without the array), arrested L1 (ok1483 homozygotes) and sterlie Dpy (mT1 homozygotes). Pick rolling non-Dpy and check for correct segregation of progeny to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.
DR1790 rol-1(e91)/mT1 II; unc-71(e541)/mT1 [dpy-10(e128)] III. C. elegans Heterozygotes are WT and segregate WT, Roller Uncs, and a few Dpy mT1 homozygotes. mT1 is an apparent II;III translocation: small broods, lots of dead eggs, and exhibits pseudolinkage between rol-1 II and unc-71 III. The Roller phenotype of rol-1 expresses late and cannot be scored before adulthood. Pick non-Unc hermaphrodites and check for correct segregation of progeny.
DR1832 mT1/unc-4(e120) II; mT1 [dpy-10(e128)]/dpy-17(e164) III. C. elegans WT phenotype. Segregates WT, sterile Dpy mT1 homozygotes, Unc-4;Dpy-17 and large numbers of arrested aneuploid embryos. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
RG3042 +/mT1[umnIs52] II; cee-1(ve542[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1124 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Pvl GFP+ non-mKate2 (ve542 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: GTTTTATGATGCTCTTCAATTCTACCGGAC ; Right flanking sequence: GCTGGTGCACCGGCTCCAGCTCCAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3044 +/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3047 +/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3061 +/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3077 +/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3094 +/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3103 +/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3116 +/mT1[umnIs52] II; rpl-23(ve616[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3117 +/mT1[umnIs52] II; dars-1(ve617[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3119 +/mT1[umnIs52] II; cpf-2(ve619[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3125 +/mT1[umnIs52] II; prx-19(ve625[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 most are sterile adults, but escapers do lay small broods (ve625 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tggaaaataactgaggacacttattgctac ; Right flanking sequence: tttggatcgataaaacacacaatcggtgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3128 +/mT1[umnIs52] II; vha-14(ve628[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3135 +/mT1[umnIs52] II; F54C8.1(ve635[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve635 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAAAGTGTGCCATGCAAAACATCAGAAA ; Right flanking sequence: GTAGATAAGCTGGTTGCCGAGGGAAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3136 +/mT1[umnIs52] II; F54C8.4(ve636[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve636 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaagatcaaaagttgaacagggagaacat ; Right flanking sequence: gggacttgaattttcggagaaagaagacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3141 +/mT1[umnIs52] II; popl-5(ve641[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3144 +/mT1[umnIs52] II; T20B12.3(ve644[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3148 +/mT1[umnIs52] II; T20B12.7(ve648[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3158 +/mT1 [umnIs52] II; dhhc-8(ve658[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are egg-laying defective, unhealthy. Deletion of 9372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 Egl-d adults (ve658 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgataatttaataaaacctctattccagtc ; Right flanking sequence: CGGACACCTTCCAGGACGGCGACGTCTCCA. sgRNA #1: tctgcatcagaccgaaattc; sgRNA #2: TAAATTCGAAATCCGGGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3164 +/mT1 [umnIs52] II; Y39A1A.22(ve664[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are slow growing, Mel. Deletion of 2999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve664 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaacctcccgaTTAGGTGTTAGTAGTGTCG ; Right flanking sequence: ggggaacactcattgatttaaatcatgatt. sgRNA #1: ATGAAAGTAGTAGTGACGAC; sgRNA #2: gcaaaaaaacacaatctcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3170 +/mT1 [umnIs52] II; uev-2(ve670[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve670 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aagatccagcttaggttcagttaacgcggc ; Right flanking sequence: tatggaatttttcagatttttctccaaaaa. sgRNA #4: GGATACTTCCATGTATCCCA; sgRNA #5: AACGTCGAATAATAGCGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3171 +/mT1 [umnIs52] II; mlc-5(ve671[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, Dpy. Deletion of 866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile Dpy adults (ve671 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaggctgaatttttgcttgagaatttctg ; Right flanking sequence: ctcggcattttccacacaatctatttattt. sgRNA #1: tttgcttgagaatttctgga; sgRNA #2: atcatttccattaatttcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3174 +/mT1 [umnIs52] II; Y43F4B.5(ve674[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve674 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atagagaaacggcaaggtcatttacctggc ; Right flanking sequence: TCTGGAAAGTGTGATTTCTGAGATGGATCA. sgRNA #1: tgtgtggatgagaaaaggcc; sgRNA #2: GGGAAAAACGCAGAATGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3178 +/mT1 [umnIs52] II; Y39A1A.14(ve678[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest w/ a few escapers. Deletion of 1011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve678 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aattaatttctccgaatttcagATGTCCCA ; Right flanking sequence: GGGGAATTATTTAAttgattttttgcagtt. sgRNA #1: GTGCAACTGTATCGTACTCG; sgRNA #2: CAGTGGACTTGAGGAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3180 eif-3.B(ve680[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 2917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve680 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gcgcttgcaacgacgctccgttctcccgca ; Right flanking sequence: tctccgtgttttctggtggtttttgccgat. sgRNA #1: actctaaacaacacccatgc; sgRNA #2: accagaaaacacggagagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3181 +/mT1 [umnIs52] II; grwd-1(ve681[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans Y54H5A.1. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1630 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve681 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTCCGGTGAAAATGACGTTGAAATGCATGA ; Right flanking sequence: TATGGGTCAGAATGAGGTCAAAGAAGTTCA. sgRNA #1: TGACGTTGAAATGCATGATG; sgRNA #2: ACAGCTGATGTTCGTCCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3190 +/mT1 [umnIs52] II; Y54H5A.2(ve690[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 12039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve690 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cacttgcagtttccgcttgatcacccaaat ; Right flanking sequence: cccgggtacgcgtccttctcaccgacaaac. sgRNA #1: ccgcttgatcacccaaatta; sgRNA #2: gtatacctcattcgcccacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3198 +/mT1 [umnIs52] II; ZK686.3(ve698[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3224 +/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5002 +/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. C. elegans umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SS746 klp-19(bn126)/mT1 [dpy-10(e128)] III. C. elegans Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.
VC1012 +/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III. C. elegans C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1038 +/mT1 II; set-16(gk438)/mT1 [dpy-10(e128)] III. C. elegans T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk438 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1046 +/mT1 II; abce-1(gk481)/mT1 [dpy-10(e128)] III. C. elegans Y39E4B.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1111 +/mT1 II; T12D8.1&T12D8.2(gk445)/mT1 [dpy-10(e128)] III. C. elegans T12D8.1, T12D8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk445 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1117 +/mT1 II; paa-1(ok1539)/mT1 [dpy-10(e128)] III. C. elegans F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1153 +/mT1 II; him-10(ok263)/mT1 [dpy-10(e128)] III. C. elegans R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1162 +/mT1 II; spe-41(ok1590)/mT1 [dpy-10(e128)] III. C. elegans K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1166 +/mT1 II; brc-2(ok1629)/mT1 [dpy-10(e128)] III. C. elegans T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1175 +/mT1 II; F37C12.13(ok1635)/mT1 [dpy-10(e128)] III. C. elegans F37C12.13. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1635 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1203 +/mT1 II; apc-2(ok1657)/mT1 [dpy-10(e128)] III. C. elegans K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1224 polg-1(ok1548)/mT1 II; +/mT1 [dpy-10(e128)] II. C. elegans Y57A10A.15. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1548 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Outer Left Sequence: ACCGTAGCCCTTTCCTCATC. Outer Right Sequence: CGCATTTCCCATCTGTCTTT. Inner Left Sequence: ACCTCTTCGTTTTGGGGATT. Inner Right Sequence: CCATCCGGCCTATTTAATCA. Inner Primer WT PCR Product: 3241. Deletion size: 2149 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1242 +/mT1 II; cup-5(ok1698)/mT1 [dpy-10(e128)] III. C. elegans R13A5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAGCCCGAAATTTTTGTAA. External right primer: CCGTAATATGTGTTGCAGCG. Internal left primer: CGTGTCTCTAGCTTCCCTGC. Internal right primer: ATCTACGTGCATTCGCACTG. Internal WT amplicon: 2867 bp. Deletion size: 1546 bp. Deletion left flank: TGCTTCTTCAAATGCTTCTCGAAGGCCAAC. Deletion right flank: ATTGTGGTCAACGATGCGCTTATTATCATT. Insertion Sequence: GTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807