Rearrangement Information
| Name | eDf18 View on WormBase |
|---|---|
| Description | =e2038 The left endpoint of eDf18 was mapped by PCR to an interval encompassing the adjacent cosmids K07H8 and F35H10. More specifically we found that eDf18 does not delete primers in F20D12, F57H12, C26B2, F42G8, C07G1, T09A12, K07H8n(5'GTGAATGCGTCCACGATGAAG and 5'CTACTTTCCTAACACTTCGCGC), but deletes primers in F35H10 (5'AGTCTCTGTACTGCTTGTTTCC and 5'CCGCTTATCTTACACTATTCAG), D2096 and T26A8. |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
Strains carrying this rearrangement
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CB3823 | eDf18/unc-24(e138) dpy-20(e1282) IV. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT. |
| CB4504 | gon-1(e1254)/eDf18 IV. | C. elegans | Heterozygotes mostly fertile at or below 20C; all sterile at 25C. Progeny are fertile heterozygotes with variable Gon abnormality, e1254 homozygotes (strong Gon, "white patch" phenotype) and eDf18 homozygotes (embryonic lethal). See also WBPaper00003841. |