Gene Information: zipt-2.1
| Name | zipt-2.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C06G8.3 |
| Genetic position | IV:4.70 +/- 0.000 cM |
| Genomic position | IV: 10799654..10802250 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3921 | zipt-2.1(gk3853[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAGATCAAAATGACAGCGGATGGCTTTCA; Right flanking sequence: CGGAGATAAATCATTTGGAAAAGATTGCAC. See WormBase Variation gk3853 for details. |