Gene Information: zipt-13
| Name | zipt-13 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C14H10.1 |
| Genetic position | X:1.90 +/- 0.000 cM |
| Genomic position | X: 10233739..10236944 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3973 | zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details. |