Gene Information: tost-1

Nametost-1 View on WormBase
Species C. elegans
SequenceC35D10.13
Genetic positionIII:-2.41 +/- 0.000 cM
Genomic positionIII: 4877526..4878311

Strains carrying this gene

Strain Genotype Description
VC4470 tost-1(gk5543[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. [NOTE: Please see RG5048 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTTATGCACCTCCGTATCACACCACCA; Right flanking sequence: TGTTGCTGTGCTCACGGTCAGCTAAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.