Gene Information: toh-1
| Name | toh-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T24A11.3 |
| Genetic position | III:-4.25 +/- 0.000 cM |
| Genomic position | III: 3804772..3809030 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4313 | toh-1(gk5396[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 4219 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTAACGTGTCCTTAAAAAGACTCAAATGTT; Right flanking sequence: AGGTAGCCTGAAATTAGATTTAAAGTAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |