Gene Information: srab-8
Name | srab-8 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C36C5.2 |
Genetic position | V:-12.73 +/- 0.000 cM |
Genomic position | V: 3176461..3177978 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4288 | srab-8(gk5371[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1276 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTATTGTGTTCCCTGATAGCATTGCC; Right flanking sequence: TATGCCGTTGTTTCTATTCTTATTTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |