Gene Information: rbm-12

Namerbm-12 View on WormBase
Species C. elegans
SequenceY106G6D.7
Genetic positionI:4.67 +/- 0.000 cM
Genomic positionI: 10122459..10130215

Strains carrying this gene

Strain Genotype Description
VC4034 rbm-12(gk5107[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Homozygous viable. Deletion of 6866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTCCTGATGGGGCTGTGCATATTATT ; Right flanking sequence: TGAGCTACTACAGAAGAAAAATGATAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.