Gene Information: rbm-12
Name | rbm-12 View on WormBase |
---|---|
Species | C. elegans |
Sequence | Y106G6D.7 |
Genetic position | I:4.67 +/- 0.000 cM |
Genomic position | I: 10122459..10130215 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4034 | rbm-12(gk5107[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 6866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTCCTGATGGGGCTGTGCATATTATT ; Right flanking sequence: TGAGCTACTACAGAAGAAAAATGATAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |