Gene Information: pqn-82

Namepqn-82 View on WormBase
Species C. elegans
SequenceY39A3CR.7
Genetic positionIII:-15.96 +/- 0.020 cM
Genomic positionIII: 1849047..1852473

Strains carrying this gene

Strain Genotype Description
BC15882 dpy-5(e907) I; sEx15882. sEx15882 [rCes Y39A3CR.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
VC3801 pqn-82(gk3768[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.