Gene Information: ocam-1

Nameocam-1 View on WormBase
Species C. elegans
SequenceT02B5.2
Genetic positionV:6.18 +/- 0.000 cM
Genomic positionV: 14167105..14167729

Strains carrying this gene

Strain Genotype Description
VC4433 ocam-1(gk5508[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Homozygous viable. Deletion of 433 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATGCGTTTTCAGATTCATCATTGAC; Right flanking sequence: ATTTCTAGCTTGAAATGGAGGAAAGTACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.