Gene Information: nep-23

Namenep-23 View on WormBase
Species C. elegans
SequenceY116A8C.4
Genetic positionIV:15.78 +/- 0.000 cM
Genomic positionIV: 16920341..16924118

Strains carrying this gene

Strain Genotype Description
VC2337 Y116A8C.4(ok3077) IV. Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807