Gene Information: lgc-7

Namelgc-7 View on WormBase
Species C. elegans
SequenceY57G11C.2
Genetic positionIV:12.39 +/- 0.005 cM
Genomic positionIV: 14709586..14714738

Strains carrying this gene

Strain Genotype Description
PS8745 lgc-7(sy1504) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTTATTATCAATATTTCAATGAATACCATGT right flanking sequence: CTGTTCTAACACTAGATCCTGCTGAAGAAACCATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCTAGTGTTAGAACAGACA Method Reference: G3 (Bethesda).