Gene Information: lgc-6

Namelgc-6 View on WormBase
Species C. elegans
SequenceF17E9.8
Genetic positionIV:3.71 +/- 0.001 cM
Genomic positionIV: 8339936..8342112

Strains carrying this gene

Strain Genotype Description
VC4022 lgc-6(gk5095[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGGTTACAATAACTCCAAATACATTTATT ; Right flanking sequence: CTTCCCATAGACCTACATTCTGACACCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.