Gene Information: lgc-42

Namelgc-42 View on WormBase
Species C. elegans
SequenceY39A3B.2
Genetic positionIII:-15.68 +/- 0.006 cM
Genomic positionIII: 1997869..2002438

Strains carrying this gene

Strain Genotype Description
PS8865 lgc-42(sy1550) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616