Gene Information: lgc-41

Namelgc-41 View on WormBase
Species C. elegans
SequenceC39B10.2
Genetic positionX:2.20 +/- 0.000 cM
Genomic positionX: 10454260..10460506

Strains carrying this gene

Strain Genotype Description
PS8729 lgc-41(sy1494) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGGCCACCAACAGCAAATGCATCAGTACCACTC right flanking sequence: GGTGTCAAACTTGGAATGTATTTGGAGAGTCTCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCCAAGTTTGACACCGAG Method Reference: G3 (Bethesda).