Gene Information: lgc-29

Namelgc-29 View on WormBase
Species C. elegans
SequenceY45G5AL.2
Genetic positionV:-6.38 +/- 0.013 cM
Genomic positionV: 4138988..4143146

Strains carrying this gene

Strain Genotype Description
PS8711 lgc-29(sy1481) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-29. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATATATTCGCTTTTATTTTATTTAATGGTCCCTCTC right flanking sequence: TGGAGCACTGATTCACAGAGCATGACGTCAGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGAATCAGTGCTCCAGAG Method Reference: G3 (Bethesda).