Gene Information: lgc-27

Namelgc-27 View on WormBase
Species C. elegans
SequenceY74E4A.1
Genetic positionII:-3.78 +/- 0.005 cM
Genomic positionII: 4649085..4653283

Strains carrying this gene

Strain Genotype Description
PS8723 lgc-27(sy1488) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-27. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACACTTTCAGTTGCCGCTTATGATATCGATTGC right flanking sequence: AAATGGAAAAGCAATATTACAGgttggtgctcaaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTATGATATCGATTGCAAA Method Reference: G3 (Bethesda).