Gene Information: lgc-27
| Name | lgc-27 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y74E4A.1 |
| Genetic position | II:-3.78 +/- 0.005 cM |
| Genomic position | II: 4649085..4653283 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8723 | lgc-27(sy1488) II. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-27. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACACTTTCAGTTGCCGCTTATGATATCGATTGC right flanking sequence: AAATGGAAAAGCAATATTACAGgttggtgctcaaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTATGATATCGATTGCAAA Method Reference: G3 (Bethesda). |