Gene Information: lgc-25

Namelgc-25 View on WormBase
Species C. elegans
SequenceR03E1.3
Genetic positionX:16.62 +/- 0.000 cM
Genomic positionX: 14158785..14161734

Strains carrying this gene

Strain Genotype Description
PS8710 lgc-25(sy1480) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cggtttcaagGGATTCTGGTAATCTGGCACCTGGA right flanking sequence: TAATCAAGTGTGTGGTCTTTCAAAAGAGCAACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACCACACACTTGATTATCC Method Reference: G3 (Bethesda).