Gene Information: lgc-24
Name | lgc-24 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C15A7.4 |
Genetic position | X:7.00 +/- 0.000 cM |
Genomic position | X: 12068550..12070563 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
PS8705 | lgc-24(sy1475) X. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda). |