Gene Information: lgc-24

Namelgc-24 View on WormBase
Species C. elegans
SequenceC15A7.4
Genetic positionX:7.00 +/- 0.000 cM
Genomic positionX: 12068550..12070563

Strains carrying this gene

Strain Genotype Description
PS8705 lgc-24(sy1475) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda).