Gene Information: lgc-21
| Name | lgc-21 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C33G3.3 |
| Genetic position | X:16.23 +/- 0.000 cM |
| Genomic position | X: 14064313..14067984 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8707 | lgc-21(sy1477) X. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGC right flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCT Method Reference: G3 (Bethesda). |