Gene Information: lgc-21

Namelgc-21 View on WormBase
Species C. elegans
SequenceC33G3.3
Genetic positionX:16.23 +/- 0.000 cM
Genomic positionX: 14064313..14067984

Strains carrying this gene

Strain Genotype Description
PS8707 lgc-21(sy1477) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGC right flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCT Method Reference: G3 (Bethesda).