Gene Information: lgc-19

Namelgc-19 View on WormBase
Species C. elegans
SequenceY105C5B.16
Genetic positionIV:14.51 +/- 0.001 cM
Genomic positionIV: 15956571..15962712

Strains carrying this gene

Strain Genotype Description
PS8702 lgc-19(sy1472) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda).