Gene Information: lgc-19
| Name | lgc-19 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y105C5B.16 |
| Genetic position | IV:14.51 +/- 0.001 cM |
| Genomic position | IV: 15956571..15962712 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8702 | lgc-19(sy1472) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda). |