Gene Information: lgc-14
Name | lgc-14 View on WormBase |
---|---|
Species | C. elegans |
Sequence | T01H10.2 |
Genetic position | X:7.01 +/- 0.000 cM |
Genomic position | X: 12111513..12113536 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4028 | lgc-14(gk5101[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGAGCTTTCTGGCATTTCCTAACCACCG ; Right flanking sequence: CTTGGTGTCTATATCATTGTGAATCTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |