Gene Information: lgc-14

Namelgc-14 View on WormBase
Species C. elegans
SequenceT01H10.2
Genetic positionX:7.01 +/- 0.000 cM
Genomic positionX: 12111513..12113536

Strains carrying this gene

Strain Genotype Description
VC4028 lgc-14(gk5101[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGAGCTTTCTGGCATTTCCTAACCACCG ; Right flanking sequence: CTTGGTGTCTATATCATTGTGAATCTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.