Gene Information: lgc-13

Namelgc-13 View on WormBase
Species C. elegans
Genetic positionX:7.01 +/- 0.002 cM
Genomic positionX: 12109166..12111300

Strains carrying this gene

Strain Genotype Description
VC4024 lgc-13(gk5097[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.