Gene Information: lgc-1

Namelgc-1 View on WormBase
Species C. elegans
SequenceT05B4.1
Genetic positionV:-6.41 +/- 0.010 cM
Genomic positionV: 4135028..4138825

Strains carrying this gene

Strain Genotype Description
PS8704 lgc-1(sy1474) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).