Gene Information: lbp-9
| Name | lbp-9 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y40B10A.1 |
| Genetic position | V:-16.01 +/- 0.028 cM |
| Genomic position | V: 2068449..2069142 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4159 | lbp-9(gk5245[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |