Gene Information: lbp-8
| Name | lbp-8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T22G5.6 |
| Genetic position | V:5.72 +/- 0.003 cM |
| Genomic position | V: 13890773..13891364 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4077 | lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |