Gene Information: klp-3
| Name | klp-3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T09A5.2 |
| Genetic position | II:0.58 +/- 0.001 cM |
| Genomic position | II: 7842353..7845653 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3138 | klp-3(ve638[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 3142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttgtctccgttttttgcgttgttttcct ; Right flanking sequence: tccattctagtccatgaaaaatttcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |