Gene Information: klp-11
| Name | klp-11 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F20C5.2 |
| Genetic position | IV:3.96 +/- 0.001 cM |
| Genomic position | IV: 8756735..8762066 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC1228 | klp-11(tm324) IV. | 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |