Gene Information: ins-10
| Name | ins-10 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T08G5.12 |
| Genetic position | V:6.08 +/- 0.002 cM |
| Genomic position | V: 14033949..14034396 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8636 | ins-10(sy1437) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda). |