Gene Information: hrpf-2

Namehrpf-2 View on WormBase
Species C. elegans
SequenceY73B6BL.33
Genetic positionIV:3.18 +/- 0.004 cM
Genomic positionIV: 6373134..6376523

Strains carrying this gene

Strain Genotype Description
VC4032 hrpf-2(gk5105[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 2633 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCATATGCAGAATGAGCAGCTGTGGGATA ; Right flanking sequence: GGTGCGGATTGAGTTTTCACTGCAATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.