Gene Information: flp-8
| Name | flp-8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F31F6.4 |
| Genetic position | X:21.48 +/- 0.007 cM |
| Genomic position | X: 14881419..14882267 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PT501 | flp-8(pk360) X. | Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82. |
| VC3728 | flp-8(gk3688[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTGGAAAAATTTGTTTTTTCGTAGATA; Right flanking sequence: AGGTGATGCAGCAGACAGATGTCACACTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |