Gene Information: flp-32
| Name | flp-32 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | R03A10.2 |
| Genetic position | X:22.63 +/- 0.000 cM |
| Genomic position | X: 15433787..15434972 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3734 | flp-32(gk3692[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |