Gene Information: fezf-1
| Name | fezf-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y38H8A.5 |
| Genetic position | IV:9.28 +/- 0.000 cM |
| Genomic position | IV: 13466097..13469399 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4073 | fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |