Gene Information: etc-1

Nameetc-1 View on WormBase
Species C. elegans
SequenceD2085.4
Genetic positionII:0.84 +/- 0.000 cM
Genomic positionII: 8664833..8669154

Strains carrying this gene

Strain Genotype Description
VC4092 etc-1(gk5182) II. Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.