Gene Information: col-88
| Name | col-88 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | W05G11.3 |
| Genetic position | III:-27.18 +/- 0.000 cM |
| Genomic position | III: 41063..41971 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8779 | col-88(sy1512) III. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCG right flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGG Method Reference: G3 (Bethesda). |