Gene Information: col-81
| Name | col-81 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F38A3.1 |
| Genetic position | II:3.14 +/- 0.002 cM |
| Genomic position | II: 11012397..11013767 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8787 | col-81(sy1520) II. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda). |