Gene Information: col-47
| Name | col-47 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y18H1A.12 |
| Genetic position | I:-18.38 +/- 0.036 cM |
| Genomic position | I: 745888..748288 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4282 | col-47(gk5365[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 2423 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCCAGAGAAGTTGGAAGTGTAGTCTT; Right flanking sequence: ACATTAAGGAGGAGCACAAAAAACACAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |