Gene Information: col-35
Name | col-35 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C15A11.1 |
Genetic position | I:2.06 +/- 0.005 cM |
Genomic position | I: 7385907..7386935 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4387 | col-35(gk5465[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 1640 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGCCATCTCAATATCTTTTTTTGCCACCG; Right flanking sequence: GAGTGATGTTTTCTTCCATTTCCACTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |