Gene Information: col-157
| Name | col-157 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T11F9.9 |
| Genetic position | V:3.16 +/- 0.001 cM |
| Genomic position | V: 11484042..11485039 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3130 | col-157(ve630[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attttgatgattcctcttgcaaatccagac ; Right flanking sequence: gttggcaaaaaaacaatattttttcctgat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |