Gene Information: col-155
| Name | col-155 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F55C10.3 |
| Genetic position | V:3.08 +/- 0.000 cM |
| Genomic position | V: 11388852..11389876 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3118 | col-155(ve618[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1138 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaattctgaatcatatatttttcaatcat ; Right flanking sequence: gtattgcaattacacttggcagatgcaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |