Gene Information: col-135
| Name | col-135 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | M199.5 |
| Genetic position | IV:12.84 +/- 0.000 cM |
| Genomic position | IV: 15129655..15131797 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8634 | col-135(sy1435) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda). |