Gene Information: col-133
| Name | col-133 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F52B11.4 |
| Genetic position | IV:11.44 +/- 0.007 cM |
| Genomic position | IV: 14098325..14099356 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3113 | col-133(ve613[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 3100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggagtacacggaagaagatgcaatgataaa ; Right flanking sequence: gatcgtagcgagacccactctgaaaaaccg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |